|
Addgene inc
plasmid plpc trf2 δb ![]() Plasmid Plpc Trf2 δb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc03961676-235-13-17?v=Addgene+inc Average 85 stars, based on 1 article reviews
plasmid plpc trf2 δb - by Bioz Stars,
2026-08
85/100 stars
|
Buy from Supplier |
|
Addgene inc
plpc nmyc trf2 ![]() Plpc Nmyc Trf2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc08152630-103-8-14?v=Addgene+inc Average 93 stars, based on 1 article reviews
plpc nmyc trf2 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pwzl hygro trf2 deltab deltam ![]() Pwzl Hygro Trf2 Deltab Deltam, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc05833687-209-39-1?v=Addgene+inc Average 90 stars, based on 1 article reviews
pwzl hygro trf2 deltab deltam - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plpc trf2 deltab deltam ![]() Plpc Trf2 Deltab Deltam, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/bio_rxiv__2021__04__06__438692-209-0-13?v=Addgene+inc Average 92 stars, based on 1 article reviews
plpc trf2 deltab deltam - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pcmv pemax pe2 gfp ![]() Pcmv Pemax Pe2 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/med_rxiv__2025__07__29__25332340-223-24-25?v=Addgene+inc Average 93 stars, based on 1 article reviews
pcmv pemax pe2 gfp - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
peg bacmam expression vector ![]() Peg Bacmam Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc11357348-358-8-12?v=Addgene+inc Average 93 stars, based on 1 article reviews
peg bacmam expression vector - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
anti tacr1 conjugated 488 scbt sc 365091 af488 ![]() Anti Tacr1 Conjugated 488 Scbt Sc 365091 Af488, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/10__7554_slash_elife__69626-204-71-65?v=Addgene+inc Average 92 stars, based on 1 article reviews
anti tacr1 conjugated 488 scbt sc 365091 af488 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pot1 overexpression plasmids plpc nmyc pot1 ![]() Pot1 Overexpression Plasmids Plpc Nmyc Pot1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc04924762__oncotarget___07___14925___s001-34-4-18?v=Addgene+inc Average 93 stars, based on 1 article reviews
pot1 overexpression plasmids plpc nmyc pot1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
ha meos3 2 donor plasmid ![]() Ha Meos3 2 Donor Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc05743434-546-1-30?v=Addgene+inc Average 85 stars, based on 1 article reviews
ha meos3 2 donor plasmid - by Bioz Stars,
2026-08
85/100 stars
|
Buy from Supplier |
|
Addgene inc
plpc trf2 δb δm plasmid ![]() Plpc Trf2 δb δm Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc10182325-35-0-6?v=Addgene+inc Average 91 stars, based on 1 article reviews
plpc trf2 δb δm plasmid - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Addgene inc
trf2 δb δm ![]() Trf2 δb δm, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc10182325-240-4-19?v=Addgene+inc Average 92 stars, based on 1 article reviews
trf2 δb δm - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
shrna trf2 ![]() Shrna Trf2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plpc+myc+trf2+addgene/pmc07706707-249-41-59?v=Addgene+inc Average 96 stars, based on 1 article reviews
shrna trf2 - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Biological Chemistry
Article Title: c-Myc Quadruplex-forming Sequence Pu-27 Induces Extensive Damage in Both Telomeric and Nontelomeric Regions of DNA
doi: 10.1074/jbc.M113.505073
Figure Lengend Snippet: Pu-27 induces phosphorylation of H2AX (γH2AX). U937 cells and ΔB-U937 cells treated with Pu-27 and were subjected to Western blot and FACS analysis. A, 3-day treatment of Pu-27 showed profound up-regulation of γH2AX expression in U937 cells but almost no changes in dB-U937 cells. Relative expressions of TRF2 in U937 and ΔB-U937 cells were also shown. TRF2 expression is down-regulated in U937 cells and no changes in ΔB-U937 cells when treated with Pu-27 (consistent with RT-PCR data in Fig. 6). Bottom panel, relative expression presented in bar graphs. *, p < 0.05. B, by FACS analysis γH2AX has shown continued to be highly expressed from days 1–3, and again there was no significant change in ΔB-U937 cells. Bottom panels, relative expression presented in bar graphs. *, p < 0.05.
Article Snippet: Aliquots of 0.4 ml of cells were transfected with 2 μg of the
Techniques: Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction
Journal: The Journal of Biological Chemistry
Article Title: c-Myc Quadruplex-forming Sequence Pu-27 Induces Extensive Damage in Both Telomeric and Nontelomeric Regions of DNA
doi: 10.1074/jbc.M113.505073
Figure Lengend Snippet: Pu-27 inhibits the molecules related to DNA damage repair machinery in U937. A, RT-PCR of U937 and ΔB-U937 cells treated with Pu-27 for 3 days. Pu-27 inhibits ATM, RAD17, RAD50, CHK14, and CHK2 but not H2AX, BRCA1, and telomerase reverse transcriptase in U937 cells. B, ΔB-U937 cells showed no changes of TRF2, TRF1, POT1, TIN2, RAD17, RAD50, and 53BP1; down-regulation of ATM; up-regulation of CHK1 and CHK2; and H2AX and BRCA1.
Article Snippet: Aliquots of 0.4 ml of cells were transfected with 2 μg of the
Techniques: Reverse Transcription Polymerase Chain Reaction
Journal: bioRxiv
Article Title: ALT Neuroblastoma Chemoresistance due to ATM Activation by Telomere Dysfunction is Reversible with the ATM Inhibitor AZD0156
doi: 10.1101/2021.04.06.438692
Figure Lengend Snippet: (A) Schematic of TRF2 and dominant- negative form of TRF2 (TRF2 ΔBΔM). (B) Immunoblotting for TRF2, pATM (S1981), ATM and β-actin in cells transduced with pLPC-nMyc or pLPC-nMyc-TRF2ΔBΔM. (C) Quantitative analysis of immunoblotting for pATM (S1981) in B and its replicates. (D) (Top panel) Representative images of telomere dysfunctional foci (TIF) analysis using IF-FISH in same cells as in B (Clone 1 only) +/-ATM inhibitor (AZD0156). 53BP1 was detected by IF (red) and telomeres by FISH with a [TTAGGG]3 probe (green). (Bottom panel) Bar graph showing meant TIF count in same cells as in B +/-ATM inhibitor (AZD0156). A minimum of 50 cells for each experimental replicate were assessed using IF-FISH. (E) DIMSCAN cytotoxicity assay curves in response to TMZ+SN-38 +/- AZD0156 in same cells as shown in C. (F) Immunoblotting for PARP, cleaved-PARP, cleaved caspase-3, and β-actin in same cells as shown in B treated with TMZ+SN-38 +/- AZD0156, cells with no treatment were included for comparison. (G) Quantification of cleaved caspase 3 and (H) cleaved PARP for immunoblot in F and its replicates. The bars represent means with SDs from three experimental replicates. Statistical significance was calculated using two-tailed t-test for G and H.****: P<0.0001; ***: P <0.001, **: P <0.01, *: P <0.05, ns: not significant.
Article Snippet:
Techniques: Dominant Negative Mutation, Western Blot, Transduction, Cytotoxicity Assay, Comparison, Two Tailed Test
Journal: eLife
Article Title: Structure of the human heparan-α-glucosaminide N -acetyltransferase (HGSNAT)
doi: 10.7554/eLife.93510
Figure Lengend Snippet:
Article Snippet: The synthesized gene was then cloned into the
Techniques: Sequencing, Expressing, Transfection, Construct, Recombinant, Plasmid Preparation, Cloning, Modification, Software, Cell Culture, Size-exclusion Chromatography, Affinity Purification, Electron Microscopy
Journal: Genes & Development
Article Title: Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore
doi: 10.1101/gad.337287.120
Figure Lengend Snippet: The NUP62 subcomplex is necessary to maintain telomere integrity in cells carrying mutant POT1. ( A ) Schematic of the nuclear pore complex in mammalian cells . Highlighted in bold are SL hits with POT1 mutants and in red are nucleoporins (NUPs) enriched in the POT1-ΔOB BioID IPs. NUP153 and TPR were hits in both screens. ( B ) Incucyte growth analysis of RPE-1 p53 −/− cells expressing POT1-WT and POT1-ΔOB, treated with shRNAs against NUP62, NUP58, and scramble control. Cell proliferation was monitored over 160h. Graph representing data from two independent experiments. ( C ) Representative images displaying telomere dysfunction-induced foci (TIFs) in RPE-1 p53 −/− cells expressing POT1-ΔOB and treated with shRNAs against NUP58 and NUP62, as well as control shRNA. 53BP1 in red is detected by indirect immunofluorescence, and telomeres are marked with FISH in green. DNA is counterstained with DAPI in blue. ( D ) Quantification of the percentage of cells with five or more TIFs in RPE-1 p53 −/− cells with the indicated treatment. Graph represents the mean of n = 3 independent experiments with SD (two-tailed t -test). ( E , F ) Analysis of telomere fragility in RPE-1 p53 −/− cells expressing POT1-WT and POT1-ΔOB and treated with the indicated shRNA. ( E ) Representative images showing metaphase chromosomes from POT1-ΔOB cells with fragile telomeres. Arrowheads indicate examples of fragile telomeres on the metaphase. Telomeres were stained with FISH in green, while DNA is detected with DAPI in blue. ( F ) Quantification of fragile telomeres per metaphase in cells with the indicated treatments. Graph represents mean of four independent experiments ( n > 40 metaphase per condition) with SD (one-way ANOVA test). ( G , H ) Telomere sister chromatid exchange (T-SCE) analysis in cells with the indicated treatment. ( G ) Image depicting metaphase chromosomes with T-SCE events (white arrows). Telomeres were stained with FISH in green and red and DNA is counterstained with DAPI in blue. ( H ) Quantification of T-SCE events per metaphase in the indicated cells ( n > 15 metaphases per condition).
Article Snippet: The shRNAs used were as follows: shRNA_NUP58-A (TRCN0000280396): CCGGGCTTCAGTTTAGGATTCAATACTCGAGTATTGAATCCTAAACTGAAGCTTTTTG; shRNA_ NUP58-B (TRCN0000013517): CCGGGCGGCACAACTTCAGTCTATTCTCGAGAATAGACTGAAGTTGTGCCGCTTTTTG; shRNA_NUP62-A (TRCN0000232576): CCGGGCAACCTCACTAATGCCATATCTCGAGATATGGCATTAGTGAGGTTGCTTTTTG; shRNA_NUP62-B (TRCN0000232579): CCGGGCTTTCATTTGAGTATCTTTGCTCGAGCAAAGATACTCAAATGAAAGCTTTTTG; shRNA_POLD3 (TRCN0000233260): CCGGGATAGTGAAGAGGAGCTTAACCTCGAGGTTAAGCTCCTCTTCACTATCTTTTTG; shRNA_SMC2 (TRCN0000291367): CCGGCCAGATTTACTCAATGTCAAACTCGAGTTTGACATTGAGTAAATCTGGTTTTTG; shRNA_TPR (TRCN0000060066): CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG; shRNA_NUP153 (TRCN0000290594): CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG; shRNA_ HUS1 (TRCN0000439497): CCGGGCGCACAGTCAGTCTTG CATTCTCGAGAATGCAAGACTGACTGTGCGCTTTTTG;
Techniques: Mutagenesis, Expressing, Control, shRNA, Immunofluorescence, Two Tailed Test, Staining
Journal: Genes & Development
Article Title: Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore
doi: 10.1101/gad.337287.120
Figure Lengend Snippet: Nuclear F-actin polymerization in POT1-ΔOB cells facilitates the relocalization of telomeres to the nuclear periphery. ( A ) Representative superresolution microscopy of a three-dimensional (3D) image through the nuclear volume of fixed RPE-1 p53 −/− cells expressing POT1-WT and POT1-ΔOB. S-phase cells were marked with PCNA (not shown) and telomeres detected with an anti-TRF2 antibody in magenta. The top image is a single z-plane through the nuclear center. The bottom image is a maximum projection rendering of all telomeres with their distance from the nuclear edge color coded. ( B ) Telomeres were identified throughout the nuclear volume and their distance to the nuclear periphery calculated using the Imaris 8.4.1 software. DAPI was used to segment nuclei into six equal volume zones from nuclear center to the periphery and each telomere assigned to the corresponding zone. The zone for each telomere relative to the nuclear periphery is identified via color coding. ( C ) Quantification of telomere localization in the nucleus of cells imaged in A , in the absence or presence of 0.2 µM Latrunculin B (LatB) treatment (24 h prior to fixation). Graph represents distribution of telomeres with respect to the nuclear periphery. Mean ± SEM (χ 2 test). n ≥ 1805 telomeres from >19 nuclei and three independent experiments. ( D ) Quantification of telomere localization in the nucleus of cells with the indicated treatment. Graph represents distribution of telomeres with respect to the nuclear periphery. Mean ± SEM (χ 2 test). n ≥ 6004 telomeres from >63 nuclei and three independent experiments. ( E ) Representative superresolution microscopy of single Z-planes taken from 3D images through the nuclear volume of fixed RPE-1 p53 −/− cells expressing POT1-WT and POT1-ΔOB. Cells were transfected with NLS-GFP-Actin and Tag-RFP-PCNA chromobodies 48 h prior to fixation. ( F ) Representative superresolution microscopy of 3D images through the nuclear volume of fixed parental RPE-1 p53 −/− cells and cells expressing POT1-ΔOB. Cells were transfected with an NLS-GFP-Actin chromobody 48 h prior to fixation and telomeres were detected with an anti-TRF2 antibody. Parental cells were treated with 0.4 µM aphidicolin for 24 h prior to fixation. ( G ) Quantification of filamentous-actin (F-actin) positive S-phase nuclei from the images depicted in E . Each data point represents an individual biological replicate. n = 3 independent experiments with >168 nuclei analyzed per experiment. SEM with Fisher's exact test. ( H ) Quantification of the percentage of telomeres that colocalized with nuclear F-actin in experiments highlighted in G . n = 3 independent experiments with >23 nuclei and >1656 telomeres. SEM with Mann–Whitney test. (**) P < 0.001; (***) P < 0.0005. Scale bar, 5 µm.
Article Snippet: The shRNAs used were as follows: shRNA_NUP58-A (TRCN0000280396): CCGGGCTTCAGTTTAGGATTCAATACTCGAGTATTGAATCCTAAACTGAAGCTTTTTG; shRNA_ NUP58-B (TRCN0000013517): CCGGGCGGCACAACTTCAGTCTATTCTCGAGAATAGACTGAAGTTGTGCCGCTTTTTG; shRNA_NUP62-A (TRCN0000232576): CCGGGCAACCTCACTAATGCCATATCTCGAGATATGGCATTAGTGAGGTTGCTTTTTG; shRNA_NUP62-B (TRCN0000232579): CCGGGCTTTCATTTGAGTATCTTTGCTCGAGCAAAGATACTCAAATGAAAGCTTTTTG; shRNA_POLD3 (TRCN0000233260): CCGGGATAGTGAAGAGGAGCTTAACCTCGAGGTTAAGCTCCTCTTCACTATCTTTTTG; shRNA_SMC2 (TRCN0000291367): CCGGCCAGATTTACTCAATGTCAAACTCGAGTTTGACATTGAGTAAATCTGGTTTTTG; shRNA_TPR (TRCN0000060066): CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG; shRNA_NUP153 (TRCN0000290594): CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG; shRNA_ HUS1 (TRCN0000439497): CCGGGCGCACAGTCAGTCTTG CATTCTCGAGAATGCAAGACTGACTGTGCGCTTTTTG;
Techniques: Microscopy, Expressing, Software, Transfection, MANN-WHITNEY